विहिवार थप ३७४९ जनामा कोरोना संक्रमण पुष्टि, ५९ जनाको मृत्यु

(दिव्य रोशनी)/ नेपालमा विहिवार थप ३ हजार ७ सय ४९ जनामा कोरोना संक्रमण पुष्टि भएको छ।
स्वास्थ्य तथा जनसंख्या मन्त्रालयका अनुसार हालसम्म संक्रमित हुनेको संख्या पिसीआर परिक्षणबाट ६ लाख १ हजार ६ सय ८७ र एन्टिजेन परिक्षणबाट १७ हजार ७ सय १४ पुगेको छ।
यसैगरी मन्त्रालयका अनुसार पछिल्लो २४ घण्टामा कोरोनालाई जितेर ५ हजार २ सय ९३ जना डिस्चार्ज भएका छन्। कोरोनालाई जितेर हालसम्म डिस्चार्ज हुनेको संख्या ५ लाख १५ हजार ५ सय ९१ पुगेको छ।
यसैगरी पछिल्लो पटक थप मृतक ५९ जनामा कोरोना संक्रमण पुष्टि भएको छ। हालसम्म कोरोना संक्रमणबाट ८ हजार २ सय ३८ जनाको मृत्यु भएको मंत्रालयले जनाएको छ।

6 thoughts on “विहिवार थप ३७४९ जनामा कोरोना संक्रमण पुष्टि, ५९ जनाको मृत्यु

  • October 25, 2022 at 6:51 am
    Permalink

    A broad range of indications for interventions in beast fibroadenoma have been introduced, including rapid growth, greater than 3 cm size, an increase in the BI RADS category, and tissue diagnosis suggestive for atypical hyperplasia or suspected phyllodes tumor stromectol tablets for humans The company later said, however, radiation levels in sea water samples taken just off the plant s coast remained below detectable levels

  • November 6, 2022 at 3:20 am
    Permalink

    Single stranded cDNA was generated by reverse transcription from 180 ng total RNA using the Superscript III First Strand Synthesis kit Invitrogen how to lose weight on tamoxifen Unexpectedly, after everyone is applause ended, Luo Jia immediately used an ink pen to cross out everything he had written before, and are written two huge Chinese characters on the whiteboard, talent

  • November 8, 2022 at 6:37 am
    Permalink

    Arch Gen Psychiatry 62 593 602 priligy equivalent A C control ovary showing large oocyte surrounded by yolk material and granulosa cells

  • November 18, 2022 at 9:30 am
    Permalink

    Wakabayashi Y, Nakada T, Murata K, Ohkura S, Mogi K, Navarro VM, Clifton DK, Mori Y, Tsukamura H, Maeda K, Steiner RA, Okamura H ivermectin for dogs For Cyclin D1, IRS 1, PR, pS2, c fos, CTGF, Cyr61, EGR1, and the ribosomal protein 18S, which was used as a control gene to obtain normalized values, the primers were 5 GTCTGTGCATTTCTGGTTGCA 3 Cyclin D1 forward and 5 GCTGGAAACATGCCGGTTA 3 Cyclin D1 reverse; 5 GCCCGTGTTACTGTTCATTCAG 3 IRS 1 forward and 5 AATAACGGACACTGCACAACAGTCT 3 IRS 1 reverse; 5 GAGTTGTGAGAGCACTGGATGCT 3 PR forward and 5 CAACTGTATGTCTTGACCTGGTGAA 3 PR reverse; 5 GCCCCCCGTGAAAGAC 3 pS2 forward and 5 CGTCGAAACAGCAGCCCTTA 3 pS2 reverse; 5 CGAGCCCTTTGATGACTTCCT 3 c fos forward, 5 GGAGCGGGCTGTCTCAGA 3 c fos reverse; 5 ACCTGTGGGATGGGCATCT 3 CTGF forward, 5 CAGGCGGCTCTGCTTCTCTA 3 CTGF reverse; 5 GAGTGGGTCTGTGACGAGGAT 3 Cyr61 forward and 5 GGTTGTATAGGATGCGAGGCT 3 Cyr61 reverse; 5 GCCTGCGACATCTGTGGAA 3 EGR1 forward, 5 CGCAAGTGGATCTTGGTATGC 3 EGR1 reverse; and 5 GGCGTCCCCCAACTTCTTA 3 18S forward and 5 GGGCATCACAGACCTGTTATT 3 18S reverse, respectively

टिप्पणी छोड्नुहोस्

Your email address will not be published. Required fields are marked *